Sex hormone-binding globulin (SHBG) gene pentanucleotide TAAAA repeat and D327N polymorphism in breast cancer: link to estrogen sensitivity
Claudia Piccioni1, Maria Graziella Catalano1, Giuseppe Boccuzzi1,2 & Nicoletta Fortunati2
Author affiliations
1Dipartimento di Fisiopatologia Clinica, Università di Torino, Torino, TO, Italy; 2SCDU Endocrinologia Oncologica, AUO San Giovanni Battista, Torino, TO, Italy.
Sex hormone-binding globulin (SHBG) is characterized by the unique ability of regulating estrogen free fraction and cross-talking with estradiol pathways in breast cancer cells, therefore reducing breast cancer cell growth and proliferation. In addition, the presence of the D327N (Asp327Asn, rs6259) single nucleotide polymorphism (SNP) of SHBG exon 8 confers a protective role to SHBG in breast cancer. Another polymorphism that has been receiving quite a lot of attention is the pentanucleotide repeat polymorphism (PNRP (TAAAA)n) within the human SHBG promoter that is characterized by a number of repeats ranging from 6 to 11. However, it has already been studied in different conditions, like PCOS, CAD, osteroporosis, at present no data are available about the (TAAAA)n polymorphism and breast cancer. In the present study, we evaluated the (TAAAA)n polymorphism of SHBG gene promoter in 198 breast cancer patients (age 57±13 years) and 61 healthy women (age 45±18 years), previously characterized in our laboratory for D327N SNP (Becchis et al. BCRT 1999; Costantino et al. BCRT 2008). The TAAAA repeat region was amplified, starting from genomic DNA of each patient, with PCR using the following primers: forward 5′-GCTTGAACTCGAGAGGCAG; reverse 5′CAGGGCCTAAACAGTCTAGCAGT; amplified products were analyzed by PAGE and the number of TAAAA repeats determined; results were confirmed by DNA sequencing. Frequencies for the different alleles were estimated by direct gene counting and compared with the χ2-test. Significance test used a two-tailed P values and statistical significance was attained for P<0.05. Breast cancer patients presented a significantly higher frequency of (TAAAA)8 with respect to healthy controls alleles (40 vs 24%; P<0.05). The higher frequency of (TAAAA)8 was also observed in tumours positive for estrogen and progesterone receptors (ER+/PR+) (38%), but not in ER−/PR− tumours (20%). Strong linkage disequilibrium between (TAAAA)8 and D327N SNP was also observed in these patients (healthy controls 39%; all breast cancers 63%; ER+/PR+ breast cancers 76%; ER−/PR− 33%). In conclusion, the (TAAAA)8 together with D327N SNP are strongly associated to estrogen sensitivity of breast cancer. SHBG genetic background could therefore be a useful tool in the evaluation of estrogen sensitivity of breast cancer.